 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| Cdr1as | |||
| Gene | CDR1as | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Cerebral development | ICD-10 | n/a (n/a) |
| DBLink | Link to database | PMID | 27391479 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | HCC tissues and adjacent non-tumor tissues, Hep3B, HepG2, SMMC-7721, Bel7402and HL-7702 |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GTGTCTCCAGTGTATCGGCG ReverseTACTGGCACCACTGGAAACC | Statistics | Fold Change : Upregulated pvalue : p<0.001 |
| Citation | |||
| Yu, L, Gong, X, Sun, L, Zhou, Q, Lu, B, Zhu, L (2016). The Circular RNA Cdr1as Act as an Oncogene in Hepatocellular Carcinoma through Targeting miR-7 Expression. PLoS ONE, 11, 7:e0158347. | |||